| 產(chǎn)品名稱 | Komagataella pastoris (Guilliermond) Yamada et al. |
|---|---|
| 商品貨號 | B168650 |
| Deposited As | Pichia pastoris (Guilliermond) Phaff |
| Strain Designations | CBS 704 [CCRC 21531, DSMZ 70382, JCM 3650, NCYC 175, NRRL Y-1603] |
| Application | Degrades ethyl alcohol ethanol
Degrades hydrogen peroxide
Produces acetaldehyde
Produces alcohol oxidase
Produces single-cell protein SCP
Produces single-cell protein from oxygenated hydrocarbons
Produces natural flavor aldehydes
Converts ethanol to acetaldehyde |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | yes |
| Preceptrol® | no |
| Genome Sequenced Strain | Yes |
| Comments | Genome sequencing strain (Institute for Applied Microbiology, University of Natural Ressources and Applied Life Sciences, Vienna, Austria; Massachusetts Institute of Technology, USA) |
| Morphology | After 3 days cells are spheroidal to ovoidal, and occur singly or in pairs.? Growth is cream-colored, dull to faintly glistening and butyrous. |
| Medium | ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GTAGCCAAAACACACTGAGTATAACTTCTAGGCTAATACACATACAACCGATTTATCTAAATCTCCTCCCAACGGATCTCTTGGCTCTCGCGACGATGAAGAACGCAGCGATCCGCGATACGTCCTGGAAGCCGCCGTGAACCATCAATTTTCGAACGCACATTGCATACAGGGAGGGTGGGGTGAGTCAATTCTCACACTCGTGGTCTAGTTTACAAAGGATGACTAATAACTTCGTCAGCCCTTACCGTTTTCTCCCCCGCCCCCTCAGA D1D2 region of the 26S ribosomal RNA gene GCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGTCCACCTTTGAAGTATTGACGTGGTTGGGAGAGGTTATTGCACAAGTCGCCTGGAACGGCCGCCAAAGAGGGTGATAGCCCCGTAGCATACAACCAATCTTCCCAGCCGACAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAAGGTGGTAGGGTCCATCAAAGACTAAATATCAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAACAGTGCGTGAAATTGGGGGGAGGGAAGGCAAGGCCACGACAGTGGTCCTGCGC |
| Name of Depositor | CBS |
| Chain of Custody | ATCC <-- CBS <-- A Guilliermond |
| Isolation | Exudate of oak; France |
| Cross References | Nucleotide (GenBank) : JQ070155 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : KU729078 ITS including 5.8S rRNA gene Nucleotide (GenBank) : CABH00000000 Komagataella pastoris DSMZ 70382, whole genome shotgun sequencing project |
| References | Duff SJB. Use of colloidal particles to improve the biocatalytic activity of microorganisms. Agric Biol Chem 54: 1879-1882, 1990. Duff SJB, Murray WD, Overend RP. Oxygen and temperature effects on acetaldehyde-induced catabolite inactivation in Pichia pastoris. Appl Microbiol Biotechnol 36: 82-86, 1991. Duff SJ, Murray WD. Comparison of free and immobilized Pichia pastoris cells for conversion of ethanol to acetaldehyde. Biotechnol. Bioeng. 31: 790-795, 1988. Duff SJ, Murray WD. Oxidation of benzyl alcohol by whole cells of Pichia pastoris and by alcohol oxidase in aqueous and nonaqueous reaction media. Biotechnol. Bioeng. 34: 153-159, 1989. Duff SJ, Murray WD. Production and application of methylotrophic yeast Pichia pastoris. Biotechnol. Bioeng. 31: 44-49, 1988. Duff SJB, et al. Production of natural flavor aldehydes from natural source primary alcohols C2-C7. US Patent 4,871,669 dated Oct 3 1989 Duff SJ, Murray WD. Production of flavor aldehydes using nongrowing whole cells of Pichia pastoris. Ann. N.Y. Acad. Sci. 542: 428-433, 1988. Duff SJB, Murray WD, Overend RP. Factors affecting the yeast-mediated conversion of ethanol to acetaldehyde in batch reactors. Enzyme Microb Technol 11: 770-775, 1989. Mattanovich D, et al. Genome, secretome and glucose transport highlight unique features of the protein production host Pichia pastoris. Microb. Cell Fact. 8: 29, 2009. Murray WD, et al. Catabolite inactivation in the methylotrophic yeast Pichia pastoris. Appl. Environ. Microbiol. 56: 2378-2383, 1990. Murray WD, et al. Induction and stability of alcohol oxidase in the methylotrophic yeast Pichia pastoris. Appl. Microbiol. Biotechnol. 32: 95-100, 1989. Murray WD, Duff SJB. Metabolism of hydrogen peroxide by Pichia pastoris. Agric. Biol. Chem. 54: 1967-1974, 1990. Phaff HJ. A proposal for amendment of the diagnosis of the genus Pichia Hansen. Antonie van Leeuwenhoek 22: 113-116, 1956. Wegner EH. Treatment of make-up water for use in a fermentation process for growth of yeast cells requiring growth factors. US Patent 4,226,939 dated Oct 7 1980 Yamada Y, et al. The phylogenetic relationships of methanol-assimilating yeasts based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Komagataella gen. nov. (Saccharomycetaceae). Biosci. Biotechnol. Biochem. 59: 439-444, 1995. PubMed: 7766181 Kurtzman CP, Robnett CJ. Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species. FEMS Yeast Res. 13: 23-33, 2013. PubMed: 22978764 Kurtzman CP. Komagataella populi sp. nov. and Komagataella ulmi sp. nov., two new methanol assimilating yeasts from exudates of deciduous trees. Antonie van Leeuwenhoek 101: 859-868, 2012. PubMed: 22302468 Kurtzman CP, Robnett CJ. Systematics of methanol assimilating yeasts and neighboring taxa from multigene sequence analysis and the proposal of Peterozyma gen. nov., a new member of the Saccharomycetales. FEMS Yeast Res 10: 353-361, 2010. PubMed: 20522116 Kurtzman CP. Biotechnological strains of Komagataella (Pichia) pastoris are Komagataella phaffii as determined from multigene sequence analysis. J Ind Microbiol Biotechnol 36: 1435-1438, 2009. PubMed: 19760441 Kurtzman CP, Robnett CJ, Basehoar-Powers E. Phylogenetic relationships among species of Pichia, Issatchenkia and Williopsis determined from multigene sequence analysis, and the proposal of Barnettozyma gen. nov., Lindnera gen. nov. and Wickerhamomyces gen. nov.. FEMS Yeast Res. 8: 939-954, 2008. PubMed: 18671746 |
| 梅經(jīng)理 | 17280875617 | 1438578920 |
| 胡經(jīng)理 | 13345964880 | 2438244627 |
| 周經(jīng)理 | 17757487661 | 1296385441 |
| 于經(jīng)理 | 18067160830 | 2088210172 |
| 沈經(jīng)理 | 19548299266 | 2662369050 |
| 李經(jīng)理 | 13626845108 | 972239479 |
